Review



pxpr 011 cas9 activity addgene  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Addgene inc pxpr 011 cas9 activity addgene
    Pxpr 011 Cas9 Activity Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 65 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pxpr+011+cas9+activity+addgene/pLX_311-Cas9+(Plasmid+%2396924)/pm40301572-264-13-15
    Average 95 stars, based on 65 article reviews
    pxpr 011 cas9 activity addgene - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Expressing:

    Article Title: Time-resolved mitochondrial screen identifies regulatory components of oxidative metabolism.
    Article Snippet: Reagents and tools table Reagent or resource Source Reference Antibodies NDUFA9 Proteintech 20312-1-AP NDUFS2 Abcam ab192022 ACAD9 Proteintech 15770-1-AP SDHA Invitrogen 459200 UQCRQ Invitrogen PA5-106446 MT-CO1 Abcam ab14705 NDUFV1 Proteintech 11238-1-AP NDUFB7 Proteintech 14912-1-AP lipoic acid Abcam AB58724 Vinculin Abcam AB207440 Goat Anti-Rabbit Ig Southern Biotech 4010-05 Goat Anti-Mouse Ig Southern Biotech 1010-05 Goat anti-mouse Dylight 800 Invitrogen SA5-10176 Alexa Fluor 680 goat anti-Rabbit Invitrogen A21076 Chemicals DMEM with glucose Sigma D5796 DMEM no glucose Gibco 11966025 GlutaMAXTM Thermo Fisher 61965-059 Fetal bovine serum Sigma F0804 MEM non-essential amino acids Thermo Fisher 11350912 D(+)-Glucose monohydrate Merck 104074 D-(+)-Galactose Merck G0750 Sucrose Merck S0389 Reagent or resource Source Reference L-Glutamic acid Sigma G1251 Puromycin Sigma P8833 Seahorse XF DMEM Medium Agilent 103575-100 Oligomycin A Sigma 04876 FCCP Sigma C2920 Rotenone Sigma R8875 Antimycin A Sigma A8674 Digitonin Sigma D141 Dodecyl-β-Dmaltoside Sigma D4641 Aminocaproic acid Sigma 07260 Imidazole Sigma I2399 Blue Comassie G Serva 17524.02 Trycine Sigma T0377 NADH Merck N8129 Nitroblue-tetrazolium Merck N6876 (+)-Etomoxir sodium salt hydrate Merck E1905 PolyFect Qiagen 301105 Polybrene Merck TR-1003-G Bradford reagent Sigma B6916 Hoechst 33342 Thermo Fisher 62249 TritonTM X-100 Merck T8787 Protease inhibitor cocktail Sigma 11836153001 Laemmli Bio-Rad #1610747 30% Acrylamide/Bis Solution, 37.5:1 BioRad #1610159 Plasmids and virus strains LentiCRISPRV2 lentivirus Addgene #52961 14 EMBO reports © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109. .. Reagent or resource Source Reference TLCV2 lentivirus Addgene #87360 pLX_311-Cas9 expression Addgene #96924 pXPR_011-Cas9 activity Addgene #59702 psPAX2 lentiviral packaging Addgene #12260 pMD2.G lentiviral packaging Addgene #12259 30% Acrylamide/Bis Solution, 37.5:1 BioRad #1610159 Oligonucleotides sgRNA RTN4IP1 Forward IDT CACCGGTACTAATCCTTCTAACTGA sgRNA RTN4IP1 Reverse IDT AAACTCAGTTAGAAGGATTAGTACC sgRNA ECHS1 Forward IDT CACCGCAGCGACTTCCCAACAGCAC sgRNA ECHS1 Reverse IDT AAACGTGCTGTTGGGAAGTCGCTGC sgRNA HIBCH Forward IDT CACCGTATTAAGAGTCAGTGCATTG sgRNA HIBCH Reverse IDT AAACCAATGCACTGACTCTTAATAC sgRNA ACAD8 Forward IDT CACCGCAAATTCACCTGGTTCAGTG sgRNA ACAD8 Reverse IDT AAACCACTGAACCAGGTGAATTTGC sgRNA ACADS1 Forward IDT CACCGACACACCATCTACCAGTCTG sgRNA ACADS1 Reverse IDT AAACCAGACTGGTAGATGGTGTGTC Commercial assays Blood & Cell Culture DNA Midi Kit Qiagen 13343 BCA assay kit Pierce 23228 Pyruvate Dehydrogenase kit Abcam ab287837 Seahorse XFe96/XF Pro FluxPak Agilent 103792-100 Other Heidolph homogenizer Hei-TORQUE 100 Heidolph 501-61020-00 Reverse-phase C18 3.5 mm, 4.6 × 150mm column Waters 186005270 Protein G-sepharose beads Merck GE17-0618-01 ..

    Activity Assay:

    Article Title: Time-resolved mitochondrial screen identifies regulatory components of oxidative metabolism.
    Article Snippet: Reagents and tools table Reagent or resource Source Reference Antibodies NDUFA9 Proteintech 20312-1-AP NDUFS2 Abcam ab192022 ACAD9 Proteintech 15770-1-AP SDHA Invitrogen 459200 UQCRQ Invitrogen PA5-106446 MT-CO1 Abcam ab14705 NDUFV1 Proteintech 11238-1-AP NDUFB7 Proteintech 14912-1-AP lipoic acid Abcam AB58724 Vinculin Abcam AB207440 Goat Anti-Rabbit Ig Southern Biotech 4010-05 Goat Anti-Mouse Ig Southern Biotech 1010-05 Goat anti-mouse Dylight 800 Invitrogen SA5-10176 Alexa Fluor 680 goat anti-Rabbit Invitrogen A21076 Chemicals DMEM with glucose Sigma D5796 DMEM no glucose Gibco 11966025 GlutaMAXTM Thermo Fisher 61965-059 Fetal bovine serum Sigma F0804 MEM non-essential amino acids Thermo Fisher 11350912 D(+)-Glucose monohydrate Merck 104074 D-(+)-Galactose Merck G0750 Sucrose Merck S0389 Reagent or resource Source Reference L-Glutamic acid Sigma G1251 Puromycin Sigma P8833 Seahorse XF DMEM Medium Agilent 103575-100 Oligomycin A Sigma 04876 FCCP Sigma C2920 Rotenone Sigma R8875 Antimycin A Sigma A8674 Digitonin Sigma D141 Dodecyl-β-Dmaltoside Sigma D4641 Aminocaproic acid Sigma 07260 Imidazole Sigma I2399 Blue Comassie G Serva 17524.02 Trycine Sigma T0377 NADH Merck N8129 Nitroblue-tetrazolium Merck N6876 (+)-Etomoxir sodium salt hydrate Merck E1905 PolyFect Qiagen 301105 Polybrene Merck TR-1003-G Bradford reagent Sigma B6916 Hoechst 33342 Thermo Fisher 62249 TritonTM X-100 Merck T8787 Protease inhibitor cocktail Sigma 11836153001 Laemmli Bio-Rad #1610747 30% Acrylamide/Bis Solution, 37.5:1 BioRad #1610159 Plasmids and virus strains LentiCRISPRV2 lentivirus Addgene #52961 14 EMBO reports © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109. .. Reagent or resource Source Reference TLCV2 lentivirus Addgene #87360 pLX_311-Cas9 expression Addgene #96924 pXPR_011-Cas9 activity Addgene #59702 psPAX2 lentiviral packaging Addgene #12260 pMD2.G lentiviral packaging Addgene #12259 30% Acrylamide/Bis Solution, 37.5:1 BioRad #1610159 Oligonucleotides sgRNA RTN4IP1 Forward IDT CACCGGTACTAATCCTTCTAACTGA sgRNA RTN4IP1 Reverse IDT AAACTCAGTTAGAAGGATTAGTACC sgRNA ECHS1 Forward IDT CACCGCAGCGACTTCCCAACAGCAC sgRNA ECHS1 Reverse IDT AAACGTGCTGTTGGGAAGTCGCTGC sgRNA HIBCH Forward IDT CACCGTATTAAGAGTCAGTGCATTG sgRNA HIBCH Reverse IDT AAACCAATGCACTGACTCTTAATAC sgRNA ACAD8 Forward IDT CACCGCAAATTCACCTGGTTCAGTG sgRNA ACAD8 Reverse IDT AAACCACTGAACCAGGTGAATTTGC sgRNA ACADS1 Forward IDT CACCGACACACCATCTACCAGTCTG sgRNA ACADS1 Reverse IDT AAACCAGACTGGTAGATGGTGTGTC Commercial assays Blood & Cell Culture DNA Midi Kit Qiagen 13343 BCA assay kit Pierce 23228 Pyruvate Dehydrogenase kit Abcam ab287837 Seahorse XFe96/XF Pro FluxPak Agilent 103792-100 Other Heidolph homogenizer Hei-TORQUE 100 Heidolph 501-61020-00 Reverse-phase C18 3.5 mm, 4.6 × 150mm column Waters 186005270 Protein G-sepharose beads Merck GE17-0618-01 ..

    Cell Culture:

    Article Title: Time-resolved mitochondrial screen identifies regulatory components of oxidative metabolism.
    Article Snippet: Reagents and tools table Reagent or resource Source Reference Antibodies NDUFA9 Proteintech 20312-1-AP NDUFS2 Abcam ab192022 ACAD9 Proteintech 15770-1-AP SDHA Invitrogen 459200 UQCRQ Invitrogen PA5-106446 MT-CO1 Abcam ab14705 NDUFV1 Proteintech 11238-1-AP NDUFB7 Proteintech 14912-1-AP lipoic acid Abcam AB58724 Vinculin Abcam AB207440 Goat Anti-Rabbit Ig Southern Biotech 4010-05 Goat Anti-Mouse Ig Southern Biotech 1010-05 Goat anti-mouse Dylight 800 Invitrogen SA5-10176 Alexa Fluor 680 goat anti-Rabbit Invitrogen A21076 Chemicals DMEM with glucose Sigma D5796 DMEM no glucose Gibco 11966025 GlutaMAXTM Thermo Fisher 61965-059 Fetal bovine serum Sigma F0804 MEM non-essential amino acids Thermo Fisher 11350912 D(+)-Glucose monohydrate Merck 104074 D-(+)-Galactose Merck G0750 Sucrose Merck S0389 Reagent or resource Source Reference L-Glutamic acid Sigma G1251 Puromycin Sigma P8833 Seahorse XF DMEM Medium Agilent 103575-100 Oligomycin A Sigma 04876 FCCP Sigma C2920 Rotenone Sigma R8875 Antimycin A Sigma A8674 Digitonin Sigma D141 Dodecyl-β-Dmaltoside Sigma D4641 Aminocaproic acid Sigma 07260 Imidazole Sigma I2399 Blue Comassie G Serva 17524.02 Trycine Sigma T0377 NADH Merck N8129 Nitroblue-tetrazolium Merck N6876 (+)-Etomoxir sodium salt hydrate Merck E1905 PolyFect Qiagen 301105 Polybrene Merck TR-1003-G Bradford reagent Sigma B6916 Hoechst 33342 Thermo Fisher 62249 TritonTM X-100 Merck T8787 Protease inhibitor cocktail Sigma 11836153001 Laemmli Bio-Rad #1610747 30% Acrylamide/Bis Solution, 37.5:1 BioRad #1610159 Plasmids and virus strains LentiCRISPRV2 lentivirus Addgene #52961 14 EMBO reports © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109. .. Reagent or resource Source Reference TLCV2 lentivirus Addgene #87360 pLX_311-Cas9 expression Addgene #96924 pXPR_011-Cas9 activity Addgene #59702 psPAX2 lentiviral packaging Addgene #12260 pMD2.G lentiviral packaging Addgene #12259 30% Acrylamide/Bis Solution, 37.5:1 BioRad #1610159 Oligonucleotides sgRNA RTN4IP1 Forward IDT CACCGGTACTAATCCTTCTAACTGA sgRNA RTN4IP1 Reverse IDT AAACTCAGTTAGAAGGATTAGTACC sgRNA ECHS1 Forward IDT CACCGCAGCGACTTCCCAACAGCAC sgRNA ECHS1 Reverse IDT AAACGTGCTGTTGGGAAGTCGCTGC sgRNA HIBCH Forward IDT CACCGTATTAAGAGTCAGTGCATTG sgRNA HIBCH Reverse IDT AAACCAATGCACTGACTCTTAATAC sgRNA ACAD8 Forward IDT CACCGCAAATTCACCTGGTTCAGTG sgRNA ACAD8 Reverse IDT AAACCACTGAACCAGGTGAATTTGC sgRNA ACADS1 Forward IDT CACCGACACACCATCTACCAGTCTG sgRNA ACADS1 Reverse IDT AAACCAGACTGGTAGATGGTGTGTC Commercial assays Blood & Cell Culture DNA Midi Kit Qiagen 13343 BCA assay kit Pierce 23228 Pyruvate Dehydrogenase kit Abcam ab287837 Seahorse XFe96/XF Pro FluxPak Agilent 103792-100 Other Heidolph homogenizer Hei-TORQUE 100 Heidolph 501-61020-00 Reverse-phase C18 3.5 mm, 4.6 × 150mm column Waters 186005270 Protein G-sepharose beads Merck GE17-0618-01 ..

    BIA-KA:

    Article Title: Time-resolved mitochondrial screen identifies regulatory components of oxidative metabolism.
    Article Snippet: Reagents and tools table Reagent or resource Source Reference Antibodies NDUFA9 Proteintech 20312-1-AP NDUFS2 Abcam ab192022 ACAD9 Proteintech 15770-1-AP SDHA Invitrogen 459200 UQCRQ Invitrogen PA5-106446 MT-CO1 Abcam ab14705 NDUFV1 Proteintech 11238-1-AP NDUFB7 Proteintech 14912-1-AP lipoic acid Abcam AB58724 Vinculin Abcam AB207440 Goat Anti-Rabbit Ig Southern Biotech 4010-05 Goat Anti-Mouse Ig Southern Biotech 1010-05 Goat anti-mouse Dylight 800 Invitrogen SA5-10176 Alexa Fluor 680 goat anti-Rabbit Invitrogen A21076 Chemicals DMEM with glucose Sigma D5796 DMEM no glucose Gibco 11966025 GlutaMAXTM Thermo Fisher 61965-059 Fetal bovine serum Sigma F0804 MEM non-essential amino acids Thermo Fisher 11350912 D(+)-Glucose monohydrate Merck 104074 D-(+)-Galactose Merck G0750 Sucrose Merck S0389 Reagent or resource Source Reference L-Glutamic acid Sigma G1251 Puromycin Sigma P8833 Seahorse XF DMEM Medium Agilent 103575-100 Oligomycin A Sigma 04876 FCCP Sigma C2920 Rotenone Sigma R8875 Antimycin A Sigma A8674 Digitonin Sigma D141 Dodecyl-β-Dmaltoside Sigma D4641 Aminocaproic acid Sigma 07260 Imidazole Sigma I2399 Blue Comassie G Serva 17524.02 Trycine Sigma T0377 NADH Merck N8129 Nitroblue-tetrazolium Merck N6876 (+)-Etomoxir sodium salt hydrate Merck E1905 PolyFect Qiagen 301105 Polybrene Merck TR-1003-G Bradford reagent Sigma B6916 Hoechst 33342 Thermo Fisher 62249 TritonTM X-100 Merck T8787 Protease inhibitor cocktail Sigma 11836153001 Laemmli Bio-Rad #1610747 30% Acrylamide/Bis Solution, 37.5:1 BioRad #1610159 Plasmids and virus strains LentiCRISPRV2 lentivirus Addgene #52961 14 EMBO reports © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109. .. Reagent or resource Source Reference TLCV2 lentivirus Addgene #87360 pLX_311-Cas9 expression Addgene #96924 pXPR_011-Cas9 activity Addgene #59702 psPAX2 lentiviral packaging Addgene #12260 pMD2.G lentiviral packaging Addgene #12259 30% Acrylamide/Bis Solution, 37.5:1 BioRad #1610159 Oligonucleotides sgRNA RTN4IP1 Forward IDT CACCGGTACTAATCCTTCTAACTGA sgRNA RTN4IP1 Reverse IDT AAACTCAGTTAGAAGGATTAGTACC sgRNA ECHS1 Forward IDT CACCGCAGCGACTTCCCAACAGCAC sgRNA ECHS1 Reverse IDT AAACGTGCTGTTGGGAAGTCGCTGC sgRNA HIBCH Forward IDT CACCGTATTAAGAGTCAGTGCATTG sgRNA HIBCH Reverse IDT AAACCAATGCACTGACTCTTAATAC sgRNA ACAD8 Forward IDT CACCGCAAATTCACCTGGTTCAGTG sgRNA ACAD8 Reverse IDT AAACCACTGAACCAGGTGAATTTGC sgRNA ACADS1 Forward IDT CACCGACACACCATCTACCAGTCTG sgRNA ACADS1 Reverse IDT AAACCAGACTGGTAGATGGTGTGTC Commercial assays Blood & Cell Culture DNA Midi Kit Qiagen 13343 BCA assay kit Pierce 23228 Pyruvate Dehydrogenase kit Abcam ab287837 Seahorse XFe96/XF Pro FluxPak Agilent 103792-100 Other Heidolph homogenizer Hei-TORQUE 100 Heidolph 501-61020-00 Reverse-phase C18 3.5 mm, 4.6 × 150mm column Waters 186005270 Protein G-sepharose beads Merck GE17-0618-01 ..



    Similar Products

    95
    Addgene inc pxpr 011 cas9 activity addgene
    Pxpr 011 Cas9 Activity Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pxpr+011+cas9+activity+addgene/pLX_311-Cas9+(Plasmid+%2396924)/pm40301572-264-13-15
    Average 95 stars, based on 1 article reviews
    pxpr 011 cas9 activity addgene - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results